restriction enzymes ddei (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
96
Structured Review
New England Biolabs
restriction enzymes ddei
Restriction Enzymes Ddei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 848 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ddei+restriction+enzyme/DdeI/bio_rxiv__64898__2026__02__24__707733-123-11-28
Average 96 stars, based on 848 article reviews
Restriction Enzymes Ddei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 848 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ddei+restriction+enzyme/DdeI/bio_rxiv__64898__2026__02__24__707733-123-11-28
Average 96 stars, based on 848 article reviews
restriction enzymes ddei - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition Article Snippet: .. Article Title: Splice-switching ASOs targeting an Alu-derived exon in the AURKA 5’UTR collapse an SRSF1-AURKA-MYC oncogenic circuit in pancreatic cancer Article Snippet: .. For SMN2 , PCR products were digested with Article Title: Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Article Snippet: .. Article Title: Study of Beta-Casein Gene Polymorphism in Gir Cattle from Gujarat State Article Snippet: The amplification was performed in a VeritiTM Thermal Cycler (Applied Biosystems, USA) using the following conditions: Amplified PCR products were confirmed by electrophoresis on 2% agarose gel stained with ethidium bromide and visualized under a UV transilluminator (Gel DocTM, Bio-Rad). .. Restriction Fragment Length Polymorphism (PCR-RFLP) and Electrophoresis For genotyping of A1/A2 alleles, 10 μL PCR products were digested with 4 units of Article Title: Genotyping the BCL11A Single Nucleotide Polymorphism and Associated Levels of Fetal Hemoglobin in Mauritanian Sickle Cell Patients. Article Snippet: Polymerase chain reaction (PCR) was performed to amplify a 739 bp fragment of exon 1 in the β-globin gene containing the βS mutation in a mixture comprising 50 μM of each oligonucleotide primer (PCO6: ATCATTCGTCTGTTTCCCATT and China I: GTACGGCTGTCATCACTTAGACCTCA) [20], 100 ng of genomic DNA, 1× PCR reaction buffer (Qiagen, Valencia, CA, USA), 3.5 mM MgCl2, 125 mM dNTP, and Taq DNA polymerase (0.2 U/μL), us- ing aMastercycler nexus (Eppendorf, Issy-les-Moulineaux, France). .. The PCR product was incubated overnight with Control:Article Title: Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition Article Snippet: .. In addition, a control digestion was performed for each studied sample with Article Title: Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Article Snippet: .. In addition, a control digestion was performed for each studied sample with Electrophoresis:Article Title: Study of Beta-Casein Gene Polymorphism in Gir Cattle from Gujarat State Article Snippet: The amplification was performed in a VeritiTM Thermal Cycler (Applied Biosystems, USA) using the following conditions: Amplified PCR products were confirmed by electrophoresis on 2% agarose gel stained with ethidium bromide and visualized under a UV transilluminator (Gel DocTM, Bio-Rad). .. Restriction Fragment Length Polymorphism (PCR-RFLP) and Electrophoresis For genotyping of A1/A2 alleles, 10 μL PCR products were digested with 4 units of Incubation:Article Title: Genotyping the BCL11A Single Nucleotide Polymorphism and Associated Levels of Fetal Hemoglobin in Mauritanian Sickle Cell Patients. Article Snippet: Polymerase chain reaction (PCR) was performed to amplify a 739 bp fragment of exon 1 in the β-globin gene containing the βS mutation in a mixture comprising 50 μM of each oligonucleotide primer (PCO6: ATCATTCGTCTGTTTCCCATT and China I: GTACGGCTGTCATCACTTAGACCTCA) [20], 100 ng of genomic DNA, 1× PCR reaction buffer (Qiagen, Valencia, CA, USA), 3.5 mM MgCl2, 125 mM dNTP, and Taq DNA polymerase (0.2 U/μL), us- ing aMastercycler nexus (Eppendorf, Issy-les-Moulineaux, France). .. The PCR product was incubated overnight with |